Ambiga, Allah and this Visit <b>Malaysia</b> Year | Journey of My First <b>Novel</b> - Blog Novel Malaysia |
- Ambiga, Allah and this Visit <b>Malaysia</b> Year | Journey of My First <b>Novel</b>
- Event Company <b>Malaysia</b> | Annual Dinner Planner ... - <b>Novel</b> M'sia
- Movie Review - <b>Novel</b> M'sia - Blogger
Ambiga, Allah and this Visit <b>Malaysia</b> Year | Journey of My First <b>Novel</b> Posted: 19 Feb 2014 03:29 PM PST Did you know that 2014 has been designated Visit Malaysia Year? Following a successful campaign in 2007, this is my country's ambitious attempt to draw even more visitors to its beautiful shores. When it comes to tourism, the Malaysian government has learnt what to say. To lure the world, Malaysia's racial, cultural and religious diversity are endlessly exploited. On a page entitled People, Culture and Language, my favourite part comes at the end of the first paragraph: "Malaysians…respect one another, regardless of one's race, religion and background. It is this 'true' Malaysian value that binds them together" (my emphasis). Indeed. Malaysia is multi-racial, multi-religious and multi-cultural. It has been this way for so long that we cannot remember a time when the country was monolithic, if indeed it ever was. And Malaysians do continue to live in relative peace and harmony with one another. But intolerance has been on the rise. I have felt this myself. I am recognisably Chinese, and during my last three visits, I was stared at by cold eyes which said: SQUATTER! I know I was not imagining this, because there were plenty of others (thank goodness) who welcomed me warmly as a fellow-Malaysian. Into this fray comes the word 'Allah'. Allah is Arabic for God, though I would liken Allah more to Almighty God, a concept pertinent to the monotheistic religions of the world. Allah has been widely used – without any issue – by Muslims, Christians and Jews in the Middle East and elsewhere. Moreover, there are claims that the word Allah pre-dates Islam. (For anyone interested, here are a few links: In the Name of Allah, The Economist Oct 15, 2013; an informative blog from the Arabic Bible Outreach Ministry; also Christian Answers which states that Jews and Christians in the Middle East called God Allah for five hundred years before the birth of the Prophet Muhammad). Within Malaysia itself, the word Allah has apparently long been used by Malay-speaking Christians, who knows for how long. Since 1615, claims the Asia Sentinel. Who can tell? All I will do here is to note that Portuguese traders actually arrived in Malacca (a well-known port in Malaysia) in 1511, and among their missionaries was St. Francis Xavier. Does any of this matter? It wouldn't, if the Malaysian government had not decided to ban the use of 'Allah' by anyone other than Muslims when referring to God. This issue, which has simmered since 2007, is not just a matter of semantics: when the use of a word is deemed to be the sole preserve of a particular group, it encourages feelings of religious exclusivism, superiority even, which in turn, breed intolerance. The loop here is subtle, self-perpetuating and insidious. I have already described the rise of intolerance in Malaysia in an earlier post (see Where is Home?). Since the Allah row broke out, a sinister new twist has been added: places of worship – a host of churches, a Sikh temple (because Malay-speaking Sikhs also use the word Allah), and in retaliation, Muslim places of prayer – have been attacked. I deplore all of these, acts which would have been unthinkable in the Malaysia I once knew. A country riven by division is not the country I want to see. Unfortunately, we can hardly count on the current government to halt the trend, since it helped create it in the first place. Tensions rose again when Malay-language Bibles (with the word Allah) were seized by the religious department. In a gesture of peace and reconciliation, Marina Mahathir, daughter of Malaysia's famous former Prime Minister, appeared with flowers at a church. This is the Malaysia I remember, yet she was far from universally applauded. Following this, the King declared that in Malaysia, the word Allah was only for Muslims. Right on cue, another church was firebombed with Molotov cocktails. Diversity itself is not the issue. There will always be divisions in any society: brown/white; Muslim/non-Muslim; Sunni/Shia; rich/poor; Chelsea fans/Arsenal fans. This last is only half a joke, my point being that any division could be turned into a fault-line if it is ruthlessly exploited. Differences do not need to become fault-lines; they only become fault-lines when a corrupt government, hell-bent on staying in power, deliberately cultivates religious and racial tensions to divide and conquer. The bigger question is this: what sort of Malaysia do we want? A country where all religions are truly respected, as the Visit Malaysia Year website tries to imply? Or a country where Islam is implicitly assumed to be superior and every non-Muslim deemed an infidel, tolerated only because s/he cannot be got rid of? I keep being told that the majority of Malaysians are like me, that they want a pluralistic, progressive, tolerant society of the twenty first century. This may be true, but we face a problem: the majority stays silent. The silence of the majority has allowed the vociferousness of a minority to shape a political agenda which has slowly but invidiously changed the country. As this thoughtful opinion in the Jakarta Post notes: "there is only a thin line between tolerance and intolerance". THERE IS ONLY A THIN LINE BETWEEN TOLERANCE AND INTOLERANCE. We should not be complacent. In a clarion call last week, a courageous lady told Malaysians that we must resist our silence and fear. Dato' Ambiga Sreenevasan, former President of the Malaysian Bar, a woman honoured by Hillary Clinton with an International Women of Courage Award in 2009 for her unstinting pursuit of judicial reform and good governance, made a speech reminiscent of Martin Luther King's. Here is part of it: "When they speak the language of racism and bigotry, we must respond with the language of unity and togetherness. When they speak the language of ignorance, we must speak the language of knowledge. When they attack our brothers and sisters, we must defend them. We must respond from a position of knowledge if we see such ignorance. When they create fear, we must respond with courage, when they divide, we must unite." (As reported by The Malaysian Insider, Feb 11 2014) No one could have put it better. Fellow-Malaysians, our despair is the enemy's biggest weapon. It is not too late to rise, to challenge bigotry when we see it, and reclaim the Malaysia we've lost. Because Malaysia Boleh (Malaysia Can). |
Event Company <b>Malaysia</b> | Annual Dinner Planner ... - <b>Novel</b> M'sia Posted: 15 Feb 2014 01:27 PM PST 1Laboratory of Plantations Crops, Institute of Tropical Agriculture, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia Received 6 June 2013; Revised 17 October 2013; Accepted 21 October 2013; Published 1 January 2014 Silicon (Si) is the second most abundant element in soil after oxygen. It is not an essential element for plant growth and formation but plays an important role in increasing plant tolerance towards different kinds of abiotic and biotic stresses. The molecular mechanism of Si absorption and accumulation may differ between plants, such as monocotyledons and dicotyledons. Silicon absorption and accumulation in mangrove plants are affected indirectly by some proteins rich in serine and proline amino acids. The expression level of the genes responsible for Si absorption varies in different parts of plants. In this study, Si is mainly observed in the epidermal roots' cell walls of mangrove plants compared to other parts. The present work was carried out to discover further information on Si stress responsive genes in Rhizophora apiculata, using the suppression subtractive hybridization technique. To construct the cDNA library, two-month-old seedlings were exposed to 0.5, 1, and 1.5 mM SiO2 for 15 hrs and for 1 to 6 days resulting in a total of 360 high quality ESTs gained. Further examination by RT-PCR and real-time qRT-PCR showed the expression of a candidate gene of serine-rich protein. 1. IntroductionAbiotic stresses, such as drought, high salinity, temperature, chilling, and high intensity light, usually affect higher plants by preventing plant growth. Improvement in biotic and abiotic resistance in crops and trees plays a vital role in both creation of sustainable agriculture systems, through suppression of deleterious effects of global warming via decreasing amounts of CO2 in the atmosphere, and provision of sufficient food sources in third-world countries. Isolation of resistance-stress genes is an important key to improve stress-susceptibility in plants [1]. Mangrove plants which grow well in plant nutrient poor conditions with high rate of salinity could be a valuable source of antibiotic and abiotic stress genes. Mangrove roots are also able to absorb water from anaerobic soils and in order to maintain the absorbed water the plants need to respire easily which is enabled by their pneumatophores or aerial roots [2]. Mangrove forests have extremely productive ecosystems with an average production of 2,500 mg C cm−2 day−1 over and above a productivity factor of 4 in the shelf regions to 40 in an open ocean [3–5]. The high rate of organic matter productivity and the external exchange with marine and terrestrial ecosystems via biochemical carbon cycling highlights the importance of the mangrove in tropical coasts [6]. Harsh environmental conditions provide for a great deal of physiological and basic adaptations in mangrove plants which consequently allow them to overcome a wide range of abiotic stresses and survive. Wetland sediments created by rivers are significantly unsteady and anaerobic as well as full of sulfates, which lead to pressure on mangrove plants to adapt as far as possible [7]. A few efforts have been made to understand the intraspecific variations of mangroves and to predict the performance of mangrove ecosystems. Mangrove ecosystems have remained almost intact as a widespread gene pool because of lack of regular morphological variations between species and among the populations, although the structure of mangrove species population for many aquatic organisms has been identified [8–11]. The major concern is to find how their genetic structure is organized and to determine the correlation between different traits, which include adaptive and nonadaptive, with migration of diverse genes, which leads to evaluation of developmental changes in mangrove ecological conditions [8]. Mangrove trees are capable of decreasing nutrient losses when there are changes in atmospheric conditions by applying a variety of mechanisms, including biogeochemical and physiological, while exposed to a waterlogged and salty environment [12–14]. Ion preservation, immobilization, and translocation in soaked soil, efficiency of nutrient use, which is the highest recorded among trees, and the morphological shape of its roots probably play an important role in establishing these mechanisms [14]. Among the plant nutrient elements in soil, Si is the most abundant, after oxygen, and essential for plant formation under poor nutrient conditions. The role of Si is not limited to plant growth as it also plays an important role in decreasing the susceptibility of plants to different environmental stresses [15–19]. Serine- and proline-rich proteins play a significant role in plants with regard to Si absorption and transportation [20, 21]. In the present study, we isolated and identified serine-rich protein genes from the roots of the mangrove plant (R. apiculata). Currently, many methods are being used to study differentials in the expression of genes including serial analysis of gene expression (SAGE), differential display reverse transcription-polymerase chain reaction (DDRT-PCR), cDNA microarray, suppression subtractive hybridization (SSH), and cDNA-AFLP. The false positive created through the SSH technique is much lower compared to that through the other methods [22, 23]. 2. Materials and Methods2.1. Plant MaterialsMangrove (Rhizophora apiculata) seeds were collected from Kuala Sepetang (04° 50.15 N, 100° 37.62 ) in Taiping, Perak, Malaysia. They were grown in hydroponic culture for two months and then treated with 0.5, 1, and 1.5 mM SiO2 for 15 hrs and for 1 to 6 days. The roots of the plants were collected, immediately washed with distilled water, and frozen in liquid nitrogen to facilitate the RNA extraction process. 2.2. Total RNA Extraction and Construction of the cDNA LibraryThe RNA extracted from the roots of the mangrove was isolated using the CTAB method [24]. The quality and integrity of the extracted RNA were assessed using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, USA). Poly(A) + RNA was extracted from total RNA using a PolyATtract mRNA Isolation Kit (Promega, USA). The subtracted cDNA library was constructed using the PCR-Select Subtractive Hybridization Kit (Clontech, USA), following the manufacturer's instructions. In brief, mRNAs from the last step for both control and treated samples were designated as driver and tester, respectively. The first-strand and double-strand cDNAs were then synthesized and the synthesized double-strand cDNA of the tester sample was digested with restriction enzyme Rsa I. The digested tester cDNA (blunt ends) was divided into two parts which were subsequently ligated with two different kinds of cDNA adaptors (long inverted terminal repeats) A and B. In order to normalize and enrich mangrove root development-related Si absorption genes that are up- or down-regulated by Si stress, two rounds of hybridizations and suppression PCR amplification were processed. The PCR products of secondary PCR amplification were then purified and inserted directly into the pDrive U/A cloning vector (Qiagen, Germany). The ligated pDrive vectors were then transformed into E. coli EZ cells and cultured overnight (16 hrs, 37°C) in LB agar medium containing X-gal, IPTG, and ampicillin. A total of 400 independent positive white clones were picked out randomly, put in LB broth containing Amp, and incubated at 37°C overnight to establish the mangrove root subtractive library. 2.3. EST Sequencing and AnalysisAbout 400 positive clones were selected randomly and amplified using M13 primers (forward and reverse) after removal of contamination from the vector and primer sequence. Before the assembly search, adaptors, polyA tails, low quality sequences, short sequences less than 100 bp in length, and vector sequences were removed. The algorithm search of contigs and singletons was performed using CAP3 software. This was followed by the obtained sequences being submitted to the NCBI database for homology search. The BLASTn was used to show degree of similarity between the clone cDNA sequence and a known sequence and the BLASTx (http://blast.ncbi.nlm.nih.gov) showed function of qualified cDNA sequences with large ORF regions. Classification of cDNA sequences was based on their E-value results in the BLAST. Categories of sequence functions are based on the Blast2GO program (http://www.blast2go.org/) [25]. Computational annotation of the mangrove EST datasets was performed using the Blast2GO software v1.3.3 (http://www.blast2go.org/). The BLAST search was performed at NCBI [26]. The degree of amino acid sequence similarity was determined by the use of Wu-Blast from EBI [27]. Hydrophilicity and hydrophobicity of serine-rich protein were predicted online by MemBrain, TMHMM, and ProtScale (http://web.expasy.org/protscale/) in the toolkit of ExPASy. Subcellular localization was investigated using PSORT II Prediction and Cell-PLoc, BaCelLo program. The prediction of secondary structure was carried out by (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html) and PsiPred program. The prediction of 3D structure was carried out by using the Pfam program. 2.4. Amplification of Full-Length cDNAThe complete CDS of serine-rich protein gene contained 696 bp and 223 amino acids. The PCR program according to KAPA HiFi Hot Start was used as follows: initial denaturation at 95°C for 5 min, 35 cycles of denaturation at 98°C for 30 s, annealing at 57.5°C for 30 s, and extension at 72°C for 1 min. The final extension was 5 min at 72°C. Agarose gel (1.5%) was used to separate PCR-amplified cDNA fragments. The expected bound about 700 bp was purified using gel purification kit (Qiagen, Germany) and 3′-dA-overhangs (incubation 72°C for 5 min) added to the blunt-ended DNA fragments generated by KAPA HiFi Hot Start DNA polymerase to ligate into the pDrive cloning vector (Qiagen, Germany) and sent for sequencing. 2.5. Semiquantitative RT-PCR AnalysisReverse transcriptase RT-PCR was performed to study the expression of the serine-rich protein gene. One μL of DNase treated (DNase I, Qiagen, Germany) total RNA from each of the mangrove roots treated with Si for 15 hrs and 1 to 6 days and untreated plants was transcribed to the first-strand cDNA using SuperScript III (Invitrogen, USA) and 500 ng oligo (dT) 18 primer in 20 μL reaction volume. Reactions were then incubated at 50°C for 60 min and heated to inactive at 70°C for 15 min. The template cDNAs for both control (untreated) and treated samples were then amplified using serine primers as F: 5-GTCATTCTGCCGAGTTCC-3 and R: 5-AATGCCCATTTATGTGACTTCG-3 designed according to the cDNA sequence homology. Actin gene as an internal control was amplified with the following primers:F: (5′CAC TAC TAC TGC TAA ACG GG AAA 3′) and R: (5′ACA TCT GCT GGA AGG TGC TG 3′). The following PCR (Tag DNA Polymerase, Vivantis, USA) program was used: 94°C for 2 min and 35 cycles of 94°C for 30 sec, 57.5 and 58°C, respectively, for actin and serine for 30 sec, and 72°C for 30 sec. The PCR program was concluded with final extension of 7 min at 72°C. Actin and serine-rich protein were amplified using the same cDNA templates. The PCR products then were separated with 1.5% agarose gel and stained with ethidium bromide. 2.6. Real-Time Quantitative RT-PCR AnalysisReal-time qRT-PCR was performed to evaluate the expression levels of candidate serine-rich protein genes in the root tissues in response to treatments with different concentrations of Si compared to these in the control plants. Total RNA was extracted from untreated and Si-treated mangrove roots. Extracted RNA was then treated with DNase (DNase I, Qiagen, Germany). The primers for the actin gene were used as in the previous section and for the second endogenous control efα1 was F 5′→ 3′ ATT GGA AAC GGA TAT GCT CCA R 5′→ 3′ TCC TTA CCT GAA CGC CTG TCA; serine-rich protein gene primer was F: 5′→3′GCAAGTGCTATGTTCAGGCA, R: 5′→3′AACAATAACGATGGCAAGGC. One μL aliquot of DNase treated RNA from each sample was used to prepare 20 μL reaction volumes (based on the KAPA SYBER FAST One-Step qRT-PCR). The reactions involved were a primary incubation of 42°C for 5 min, inactive RT at 95°C for 5 min, followed by 40 cycles at 95°C for 3 sec, 60°C for 30 sec, and 72°C for 3 sec. The 96-well plate was used to analyze each sample in duplicate. In this study all data was from four independent biological replicates. A standard curve ( ) from 10-fold serial dilutions was generated from the purified cDNA fragments of internal and serine-rich protein genes (102, 10, 1, 10−1, and 10−2 ng/μL). 3. Results3.1. Yield and Integrity of RNAThe RNA appeared as a nondegraded band on 1.5% agarose gel containing formaldehyde. The A260/280 ratios ranging from 1.9 to 2.02 indicate that there was no protein contamination and the A260/230 ratio >1 demonstrated that there is no polyphenol or polysaccharide contamination [28]. The RNA concentration was in the range of 0.5–1.2 mg g−1. The poly(A) + RNA of both treated and untreated samples appeared as clear smears on the 1% agarose gel with the A260/280 ratio = 2 indicating high quality of mRNA obtained for further analysis. 3.2. Construction of the Subtracted cDNA LibraryThe products of the subtracted suppression hybridization cDNA library appeared on 1.2% agarose gel as a smear with ranking size from 150 bp to 1.2 kb and 4–6 separate bands (Figure 14, line A) which obviously differentiates them from the unsubtracted sample driver (Figure 14, line B). The results of the SSH cDNA library indicated that the differentially expressed genes are present in the tester or treated samples and absent or present at lower levels in the driver or untreated samples. For further confirmation of subtraction analysis efficiency, expression of the actin gene was examined in both the driver and control samples via 23 and 33 cycles of amplification, respectively, indicating that cDNA homologue was removed from both the tester and driver samples by subtraction (Figure 14). 3.3. ESTs Sequencing and Gene AnnotationAbout 700 positive recombinant clones were isolated from the cDNA library. Of those, about 400 clones were randomly selected, sequenced, and analyzed to isolate the gene(s) involved in Si transportation and absorption. The 322 ESTs sequences were coalesced into 21 contigs and 13 singletons by CAP3 assembly program. About 19.5% of the ESTs resulting from this library did not have any significant homology to any of the proteins existing in the database. The DNA fragments involved in the subtracted cDNA library varied in size, more or less between 100 and 650 bp (Figure 1). Average length of high quality ESTs is 350 bp. The most plentiful BLASTx hits correlated to species distribution related to Lilium longiflorum, Glycine max, Cupressus sempervirens, and Arabidopsis thaliana (Table 1 and Figure 2). Table 1: Putative identities of novel silicon-induced cDNA sequences expressed in R. apiculata roots. Figure 1: Number of sequences with length which resulted from the subtracted cDNA library. Figure 2: Top hit distribution of ESTs analysis. 3.4. Classification of Differentially Expressed GenesAccording to gene annotation, the 322 ESTs were divided into three different groups involving biological process, molecular function, and cellular components (Figure 3). The potential identities of the genes are based on similarities to those present in the Gen-Bank databases. The genes obtained by the SSH library classified by biological process involve 5 different groups: ATP synthase (88.9%), equilibrative transporter (4.4%), auxin-responsive protein (2.2%), mitochondrial protein (2.2%), and copia-type polyprotein (2.2%); those classified according to cellular components involve 3 different groups. The ATP synthase was highly abundant in both the cellular components and biological process categories (Figures 4 and 5), while senescence-protein was the most abundant group in the molecular function category (Figure 6). Classification of the ESTs resulted in 94% of known, 4% hypothetical, and 2% unknown functions. Figure 3: Gene annotation of 322 ESTs which resulted from the SSH library. Figure 4: Cellular components categorization of cDNA library result. Figure 5: Biological process categorization of the subtracted cDNA library. Figure 6: Molecular function categorization of the subtracted cDNA library. 3.5. Isolation of the Full-Length Serine-Rich Protein GeneOne of the ESTs sequence showing 97% similarity involves the ATG codon (20% query cover region) with complete CDS of the serine-rich protein gene of Arachis hypogaea (Figure 7). Full length of the gene (Figure 8) was obtained through amplification of the cDNA template (First-Strand cDNA synthesis, Invitrogen, USA) and using gene-specific primers as follows: serine F: 5′ → 3′ GTCATTCTGCCGAGTTCC R: 5′ → 3′AATGCCCATTTATGTGACTTCG. Figure 7: Relative quantity of serine-rich protein gene and actin as an internal control. Serine 15 h sample group is not different to control group. P value = 0.169. Serine 1 day is up the regulated in sample group (in comparison to control group). P value = 0.000. Serine 2 days is up-regulated in sample group (in comparison to control group). P value = 0.000. Serine 3 days sample group is not different to control group. P value = 0.339. Serine 4 days is up-regulated in sample group (in comparison to control group). P value = 0.000. Serine 5 days is up-regulated in sample group (in comparison to control group). P value = 0.000 Serine 6 days is up-regulated in sample group (in comparison to control group). P value = 0.000. Figure 8: The nucleotide (696 bp) and deduced amino sequence (223 aa) of serine-rich protein. 3.6. Analysis of the Differential Expression of Serine-Rich Protein Gene Using Semi-qRT-PCR and Real-Time qRT-PCRThe semiquantitative RT-PCR analysis showed that the expression levels of serine-rich protein were generally higher in the Si treatment samples than in the untreated samples. The expression level of serine-rich protein in the 3-day treated sample was lower compared to that in the other treated samples with varying periods of time (Figure 15). Real-time qRT-PCR confirmed the results of the semi quantitative RT-PCR (Figure 8). The relative transcript abundance of serine-rich protein in Si-treated plants was higher compared to that in the untreated plants. The PCR efficiency of all reactions in this study was between 87 and 98%. The REST software (Qiagen, Hilden, Germany) was employed to analyze the results of the qRT-PCR. The manufacturer's instructions were followed to quantify the relative gene expression. Differences among treatment samples were noted as being statistically significant ( ). 3.7. Bioinformatics AnalysisThe low quality regions at the end and beginning of each sequence were trimmed using a Phred 20 cutoff value. Vector screening was carried out using the crossmatch. Oligo dT tracks and other contaminants were removed. Algorithms of CAP3 [29] assembly were used to assemble the individual ESTs into clusters of sequences derived from the same transcript as tentative consensus sequences (TCs) and singletons representing unique transcripts. Obtained sequences were submitted to NCBI database. Prediction of hydrophilicity and hydrophobicity is needed for predicting protein secondary structure and division of functional domain, according to the theory that hydrophilicity and hydrophobicity are related to the score of amino acid. Based on the number of hydrophilic amino acid residues, we could hypothesize that the serine-rich protein was a hydrophilic protein (Figures 9 and 10). Figure 9: Analysis of hydrophilicity and hydrophobicity for the serine-rich protein. This figure is the ProtScale output of hydrophilicity and hydrophobicity for the serine-rich protein. Figure 10: Amino acid composition of serine-rich protein. 3.8. The Prediction of Secondary Structure and Function Domain of Serine-Rich ProteinThe prediction results of secondary structure of serine-rich protein by PsiPred showed that the secondary structure consisted of 11 sheets, 3 helixes, and 15 coils (Figure 11). Computational analysis of the cDNA clone isolated from mangrove root library indicated that its 696 bp coding region codes for a protein of 223 amino acids with a predicted molecular mass of 24.21 kDa. Homology searches run with the full-length amino acid sequences. Figure 11: Prediction of secondary structure for the serine-rich protein. 3.9. Subcellular LocalizationThe prediction of subcellular localization with Cell-PLoc, BaCelLo, and WoLF PSORT showed that serine-rich protein is likely to be localized in chloroplast, plastid, and mitochondrion, with a different probability of 17, 5, and 1%, respectively (Figure 12). Biosequence analysis of coding sequence region (CDS) of serine-rich protein using profile hidden Markov models (HMMER) showed 60% similarity to serine-rich protein of Arachis hypogaea (TR:Q0MX20_ARAHY) and 100% similarity to mitochondrial protein of Medicago truncatula (TR:G7I9T8_MEDTR) (Table 2). Table 2: Pfam domain search option for genomic and proteic annotation. Figure 12: Prediction of subcellular location of serine-rich protein. 3.10. Prediction of 3D StructureIn order to predict the 3D structure of serine-rich protein, the Phyre2 (Protein Homology Analogy Recognition Engine) server was used [30]. A Phyre2 output model was generated based on the template galactose-binding domain-like. Structural alignment of serine-rich protein and galactose-binding domain-like was performed using the Matchmaker tool of UCSF Chimera [31]. The 3D structure protein of serine-rich protein gene isolated and identified in the present study submitted to NCBI with accession number KF211374 involves MYP, b/Zip, LCR1, and DOF transcription factor binding motifs (Figure 13). Figure 13: 3D structure of serine-rich protein. The protein folds are shown in the colors of the rainbow from the N terminus (blue) to the C terminus (red). Figure 14: Result of the SSH cDNA library. Lane M: marker; lane A: subtracted driver sample after second PCR; lane B: subtracted tester sample after second PCR. Figure 15: Relative expression of serine-rich protein gene (a) and actin as an internal control (b) was amplified by semi-qRT-PCR. L: molecular ladder, M: untreated plants, A: 15 hrs silicon treated, B: 1-day silicon treated, C: 2-days silicon treated, D: 3-day silicon treated, E: 4-day silicon treated, F: 5-day silicon treated, and G: 6-day silicon treated. 4. DiscussionIn the present study, the suppression subtractive hybridization (SSH) method was used to identify differentially expressed genes present in the tester sample and absent or present at lower levels in the driver. The SSH cDNA library was constructed using SiO2-treated (15 hrs and 1 to 6 days) roots of mangrove plants, whereby 321 unique genes were obtained. The SSH method provides information related only to global analysis of gene expression, and hence semi quantitative RT-PCR and real-time qRT-PCR were performed to evaluate the quantitative level of gene expressions over varying periods of Si treatment. Most sequences recognized from this subtracted library encoded different genes with homology of genes from 13 known and 2 unknown species. One EST with known function was selected for analysis of Si-induced expression patterns in varied periods of time using semi quantitative reverse transcriptase and real-time qRT-PCR (Figures 15 and 7). The SSH cDNA library of Si-treated genes was monitored for seven times. From SSH reports, it appears that some gene induction patterns are so rapid and self-motivated that they may not be detected by Si stress applied. The results of the SSH library constructed in this study contain the majority of induced genes, such as serine-rich protein which was upregulated and recovered from the roots of two-month old mangrove seeds after Si treatment. Previous studies identified Lsi1, Lsi2, and Lsi6 as the genes responsible for Si transportation and accumulation, isolated from roots and leaves of rice and corn. The capability of an influx transporter on one side and an efflux transporter on the other side of the cell to permit effective transcellular transport of the nutrients was revealed after identification of Lsi1 and Lsi2. The protein encoded by these genes is localized, like Lsi1, on the plasma membrane of cells in both the exodermis and the endodermis. However, in contrast to Lsi1, which is localized on the distal side, Lsi2 is localized on the proximal side of the same cells [32]. Meanwhile, Yamaji et al. [33] reported on the role of Lsi6 in plant nutrient redirection at the node I part. A corollary to Yamaji's [33] result is that the role of Lsi6 could be as a transporter involved in intravascular Si transportation. In the present study, it is reported that the serine-rich protein could have a similar role in mangrove roots. The presence of a trichloroethyl-ester-protecting group and an alcoholic-hydroxyl-group-protecting group in serine is easy to strip down [20] when subjected to modification with higher Si content. Furthermore, serine derivatives can selectively take part in a plurality of chemical reactions and generate derivatives that can perform multiple derivatization reactions [20]. Apart from serine-rich proteins some other glycoproteins and polysaccharides may have roles in Si transportation and accumulation. For instance, Kauss et al. [21] argued that the results of Si deposition did not follow an equal independency from accumulation of phenolics in every plant. Moreover, Perumalla and Heath [34] mentioned that 2,2′-dipyridl, an iron-chelating inhibitor of proline hydroxylation, decreased the number of Si deposition sites. Hence, there is a relationship between availability of proline and deposition of Si in plants. Mangroves in association with Si may involve many glycoproteins and polysaccharides enriched by many amino acids, including threonine, proline, serine, glycine, glutamic acid and aspartic acids, which are OH-terminated. The SSH library was successful in identifying 4 ESTs associated with the serine-rich protein mRNA, the sequence submitted to the Gen-Bank (Access. number DQ834690.1), and 2 ESTs associated with proline-rich proteins, the sequence submitted to the Gen-Bank (Access. number AAB70928.1). It has been reported that these polysaccharides play an important role as stable intermediates in Si accumulation, transportation, and nucleation [20, 21]. Many ESTs associated with transcription regulatory and signal transduction were isolated from the Si-induced mangrove SSH library, including ATP synthase subunit beta, mitochondrial protein, and auxin-responsive protein. Several ESTs isolated were homologous to senescence-associated proteins. Senescence-associated protein functions as a defense mechanism in response to diseases caused by fungi, bacteria, and viruses [35]. Several ESTs isolated from the SSH library were homologous to cytochrome p450-like tbp protein involved in molecular functions, such as hydroxylation and molecular trajectories for hydroxylation [36]. The other less abundant ESTs identified by the SSH library involved one EST, which was homologous to the equilibrative nucleoside transporter (Gen-Bank Access. number XP_002317251.1); four ESTs associated with rRNA intron-encoded endonuclease (Gen-Bank Access. number BAD18905.1); one EST homologous to protein binding protein, putative (Gen-Bank Access. number XP_002515352.1); one EST associated with 3-dehydroquinate synthase, putative (Gen-Bank Access. number XM_003588307.1); one EST homologous to mitochondrial protein, putative (Gen-Bank Access. number AES58606.1); and one EST homologous to copia-type polyprotein (Gen-Bank Access. number CAB71063.1). The analysis and EST data presented here are a first global overview of Si absorption genes in mangrove. The annotation of these ESTs has identified many genes associated with or having a potential role in Si absorption. These genes provide a starting point for understanding the nature of molecular mechanisms of plant's Si absorption. Energy conversion processes of the protein of interested gene are involved in increasing the amount of some amino acids, such as serine and glutamic acid, as we observed in the other study which has been done over a functional study of the transgenic Arabidopsis thaliana using the HPLC method. On the other hand it has been reported that the biosilica formation in different organisms is under control by increase in the amount of some amino acids, such as serine and proline. Hence, we concluded that transformation of serine-rich protein can be effective in Si absorption and accumulation. In conclusion most of Si-induced SSH mangrove roots were observed to have a putative or known function, whereas some of the ESTs isolated from the SSH have never been recorded from other plant species. Unrecorded genes may have different functions that play different roles in plants and understanding of their functions would be useful in identifying the mechanisms involved in plant breeding and development. In the next phase of experiments the full-length copy of the serine-rich protein will be cloned following transgenic Arabidopsis thaliana and its function as Si transporter gene analyzed. Conflict of InterestsThe authors declare that there is no conflict of interests regarding the publication of this paper. AcknowledgmentThe senior author (Mahbod Sahebi) would like to express sincere gratitude to Universiti Putra Malaysia (UPM) for the financial support provided through the RUGS research Grant no. 9327800 and research facilities. |
Movie Review - <b>Novel</b> M'sia - Blogger Posted: 11 Feb 2014 01:28 PM PST About my Find Not too long ago when I stopped in Kuala Lumpur and visited the splendid Kinokuniya Bookstore, this quaint treasure of a children's poetry book, beckoned to me shyly, from a locked glass showcase. There it waited…a handsome Malaysian antiquarian item… regally poised in all of its ancient glory. The beautifully preserved First-hand edition titled Haji's Book of Malayan Nursery Rhymes, stood silently with several other sterner out-of-print hardback editions; all determined to feature tales and essays of an older Malaya, still laden with her sharp aristocratic flavour. Never you mind that in the same fashion which may have just as well befitted a toffee-nosed mannequin marvellously holding every strand in place, neither too would any page or content be held amiss. With a gasp, I was thrown from adulthood into the enthrallment of a child's simple joys, than apparent in Klang town's famous Caxton Bookshop on Rembau Street. Back in the 1960s and 1970s, the groundfloor that made for a row of rambling old shophouses, ran riot with jigsaw puzzles and picture books. My thoughts fell instantly into a cache of abundant memories, so gracefully matched with the wonder of the moment. I felt ironically blessed for a birthday that had now stumbled into the late summer of my life. While happily encased in the present New Age digital world, I had once tasted the fading influences of British colonalism in the Far East, also. This, not to be imagined from novels but the real thing. How richly then had the literary influences of England been stirred into a potpourri of multicultural Malay, Chinese, Indian, Sikh and Eurasian communities with nary a complication, at least not that was offered to a child's visible notions. This of course, combined with varied enchanting storytelling elements that each culture so liberally allowed for its leisurely moments. Without hesitation, I purchased the only edition that appeared to be present. It set me back RM690 (about 150 euros). Of course, there were vital reasons for this. Book-collecting of somewhat rare and personal gems had turned into a passionate hobby and here was an opportunity too good to miss. Besides, I was seduced by the vault of memories that had so quickly engulfed me…that familar seduction of late, that demanded I write a novel on my childhood. Caption: A little Malay girl in her sandals, stares anxiously at the heavy pelts of tropical rain being blown about by the wind while being kept dry by a hardy umbrella. About the Author Sadly, I know scant about A.W. Hamilton although I did receive a strong impression of his dedication to the Malay Language and I am familiar with his selection of pantuns. The trouble is as children we recite the poems, ballads, tales and songs with whoops of relish and later, mentally store away renditions with an equal fervour, but at such a tender age, spare little thought for the person who wrote them. Among a few of his works, I would discover Hamilton's Malay Pantuns, Malay Proverbs – Bidal Melayu and Malay Made Easy – Covering the Dutch East Indies and Malaya. About the Book Mine's a densely speckled and yellowed version of a 1956 reprint, published by the then Donald Moore Ltd, at MacDonald House on Orchard Road, Singapore. Haji's Book of Malayan Nursery Rhymes had been treated to its first publication in 1939, three years before the start of the Japanese Occupation as a result of World War II, in the Malayan Peninsular, Borneo and Singapore. The second reprint would be later published in Australia in 1947. I get the clear impression before feeling subsequently thrilled that the copy now lining my library shelf, had surely passed through several appreciative hands once upon a time, in the forgotten past. What I found fascinating was Hamilton's Preface. He wrote that some of the Malayan Nursery Rhymes received their original publication as early as 1922 in pamphlet form, at the time of the Malaya-Borneo exhibition. They were then reprinted the following year, by the Methodist Publishing House in Singapore where the local poems were issued with both cardboard covers and illustrations, as an added attraction. In his Preface, Hamilton also wrote most humbly that he considered the Malayan poems he so ably translated from a numerous collection of popular English rhymes, to be recognised as a product of Malaya and that he would take no credit for his industry. He dedicated the verses and what may even be viewed as limericks… solely for the indulgence of the little folk. Caption: In a kampung, an old crooked man labelled as 'orang bongkok' takes a slow stroll to his attap home, held deftly by stilts. Next to his hut, lies a coconut tree. Here are a few examples: Georgie Porgie Georgie Porgie, pudding and pie, Kissed the girls and made them cry; When the girls came out to play, Georgie Porgie ran away. Now, the old Malay version would read: Awang Bawang Awang Bawang, kachang kobis, Chium anak dara, nangis; Bila kawan keluar chari, Awang Bawang sudah lari. - Excerpt taken from Haji's Book of Malayan Nursery Rhymes. and for another example, Hey, Diddle Diddle Hey! Diddle, diddle, The cat and the fiddle, The cow jumped over the moon; The little dog laughed To see such sport, And the dish ran away with the spoon. Here, the Malay version would read: Kuching Dengan Biola Hai! mula-mula, Kuching dengan biola; Lembu melompat ka-bulan. Anak anjing ketawa, Suka tengok melawak, Dan sendok di-larikan pinggan. - Excerpt taken from Haji's Book of Malayan Nursery Rhymes The book still slightly frail in my hands, is made up of about a 100 pages of a commendable compilation of English rhymes. These are followed simulatenously by translations; each rhyme pairing up with a Malay version, featuring the older Malay vocabulary and spelling. Now, I was familiar with these as we still studied the older version for a while in the classroom, before an overhaul of the language took place a little later. Several of the couplets are rather short, resulting in quite a few poems scattered together on a solitary page. The book ends with an added seven pages, featuring nothing but a heavy glossary of English-Malay definitions, giving me another distinct impression of how thorough a writer A.W. Hamilton was and of how much pride he placed in his work. Caption: A merry band of children link hands and dance round a banana tree while singing a Malay rendition of 'Round the Mulberry Bush' About the Illustrations I was really bowled over by the illustrations and I have placed a few here in this post. In his Introduction, Hamilton also took time out to thank Mrs Nora Hamerton, who I gather was already a well-known illustrator in Malaya, during the time. She is mentioned a few times on the web and I was delighted to read that Badan Warisan Malaysia, had described Hamerton's early illustrations as a fine piece of work. I wish more accolades had been awarded her and that there would have been an appropriate biographical detail to her artwork, that would have been easily accessible. Perhaps not even that, but just merely for Nora Hamerton to have been better celebrated for her artistry and talent. I also observed that Hamerton had worked with Hamilton on other childrens' books too. Once more, the poet and translator mentioned in his Preface that Nora Hamerton had resided in Kapar, Selangor. That drew this book really close to home for me. Although the thoughtful artist graced my patch many many years before I was born, my eyes still shone with excitement to read that the illustrator had lived on the fringes of Klang, where I myself had been raised in the Sixties. I was tickled by some of the illustrations especially that of an old Tamilian lady who wore her saree with no blouse under the wrap. I remembered with a start that as a little girl, I often saw older ladies like these sauntering on the roadside, where they lived in nearby squatters made up of attap houses or trooped down into town, from the neighbouring palm oil estates. The memory was especially distinct as I remember the sarees in rainbow hues as was the fashion during the time ie. an electrifying pink, a lime green or sky blue etc. Without a doubt, some of the toothless wizened women attracted public attention but seemed oblivious of it. The illustrations envelop all the races and I was touched to see also, a Nyonya mother and her child in their costumed regalia. What a fine journey into the past from a little book festooned with nostalgic literary delights, still young to the mind after the twilight toil of long and winding roads. - susan abraham Further Reading: i) For further reading, you may like to engage in the following essay, published in a French journal and titled: The Poetics of the Pantun. ii) A collection of definitions affliated to the Pantun in English may also be found HERE. |
You are subscribed to email updates from Novel Malaysia - Google Blog Search To stop receiving these emails, you may unsubscribe now. | Email delivery powered by Google |
Google Inc., 20 West Kinzie, Chicago IL USA 60610 |
No comments:
Post a Comment